Korean Journal of Pharmacognosy
[ Original Article ]
Korean Journal of Pharmacognosy - Vol. 56, No. 1, pp.27-31
ISSN: 0253-3073 (Print) 2288-9299 (Online)
Print publication date 31 Mar 2025
Received 13 Jan 2025 Revised 10 Feb 2025 Accepted 28 Feb 2025
DOI: https://doi.org/10.22889/KJP.2025.56.1.27

종 특이 분자마커를 이용한 Pinellia 속 3종의 유전자 감별법 개발

김봉섭1 ; 김재환1 ; 김규헌1, * ; 이우규1 ; 김진철1 ; 이상민1 ; 박지영1 ; 이성미1 ; 오세욱2 ; 황인영1 ; 김종환1 ; 황진희1
1식품의약품안전평가원 의료제품연구부 생약연구과
2식품의약품안전처 바이오생약국 한약정책과
Development of a Genetic Identification Method for 3 Species of Genus Pinellia Using Species-Specific Molecular Markers
Bong-Sub Kim1 ; Jae Hwan Kim1 ; Kyu-Heon Kim1, * ; Woo Kyu Lee1 ; Jin Chul Kim1 ; Sang Min Lee1 ; Ji-Young Park1 ; Seong Mi Lee1 ; Seh Wook Oh2 ; InYeong Hwang1 ; Jonghwan Kim1 ; Jinhee Hwang1
1Herbal Medicine Research Division, National Institute of Food and Drug Safety Evaluation, 187 Osongsaengmyeong 2-ro, Osongeup, Heungdeok-gu, Cheongju-si, Chungcheongbuk-do 28159, Korea
2Herbal Medicine Policy Division, Ministry of Food and Drug Safety, 187 Osongsaengmyeong 2-ro, Osongeup, Heungdeok-gu, Cheongju-si, Chungcheongbuk-do 28159, Korea

Correspondence to: *(E-mail) : khkim95@korea.kr (Tel) : +82-43-719-4816

Abstract

Pinellia Tuber is defined as Pinellia ternata Breitenbach (Family Araceae), according to the Korean Pharmacopoeia (KP). Recent studies have reported the mass production of Pinellia Tuber using tissue culture technology. However, somatic variations during tissue culture have been reported to produce tuber forms resembling those of P. pedatisecta. Additionally, the potential for closely related species, such as P. tripartita and Typhonium flagelliforme, to be distributed as Pinellia Tuber should be monitored carefully for species identification. In this study, we identified indel (insertion/deletion) regions through a comparative analysis of chloroplast genomes and developed specific markers to distinguish P. ternata (182 bp) from P. pedatisecta (352 bp) and P. tripartita (388 bp). Using the developed marker (CP_2F/2R), we established a genetic analysis method that enables the effective and rapid identification of Pinellia Tuber and its potential substitutes with a single PCR reaction. This method can also detect the presence of P. pedatisecta contamination in mixed samples. The proposed approach is expected to contribute to the quality control of Pinellia Tuber, a frequently prescribed herbal medicine, and to prevent misidentification or adulteration.

Keywords:

Pinellia Tuber, Pinellia ternata, Genetic identification, Molecular marker

반하(半夏)는 「대한민국약전」(KP)에 등재된 품목으로, 그 기원을 Pinellia ternata Breitenbach (천남성과 Araceae)의 덩이줄기로서 주피를 완전히 제거한 것으로 규정하고 있다.1) 반하는 한국, 중국 및 일본 등 주로 동북아시아에서 약재로 이용하고 있으며,2) 중화인민공화국약전(ChP), 일본약국방(JP), 대만중약전(THP), 조선민주주의인민공화국약전(DP)에도 기원종을 반하(P. ternata)로 기술하고 있다. 한약재 반하는 진해, 거담, 이뇨, 진토, 두통 등에 약리적 효능이 있는 것으로 알려져 있어3) 구토, 기침, 두통, 급성위염 등에 이용되어 왔다.4) 또한, 반하는 국내에서도 자생 또는 재배되고 있으나 주로 외국에서 수입∙유통되고 있으며,4,5) 2018년부터 2023년까지 한약재 수입액 상위 10개 품목에 포함되어 있는 다빈도 한약재로 볼 수 있다.6)

반하와 오혼용 될 수 있는 대표적인 식물로는 호장남성(Pinellia pedatisecta), 대반하(Pinellia tripartita) 및 수반하(Typhonium flagelliforme)가 있다.7) 수반하의 경우 형태 구별이 비교적 용이하나, 최근 조직배양 기술을 이용한 반하의 대량 생산 연구에 따르면, 조직배양 시 체세포변이가 발생되어 반하의 형태가 호장남성과 유사할 수 있어4,8) 이를 대비하기 위한 명확한 감별법 개발이 요구되고 있다. 또한, 대반하(P. tripartita)는 국내에서 수집∙재배되어 반하로 유통될 가능성이 있기 때문에 이에 대한 대비가 필요한 상황이다.9)

반하와 오∙혼용 우려가 있는 식물을 감별하기 위한 연구로 DNA 바코드 분석법9) 및 SCAR 마커 분석법10) 등 유전자 분석을 이용하여 신속하고 정확한 종 판별이 가능한 연구가 보고된 바 있다. 또한, 동시에 여러 종을 동정할 수 있는 Multiplex-PCR 기법이 많이 활용되고 있으나, 분석 과정에서 프라이머(Primer) 조성 비율과 반응성을 고려해야할 뿐만 아니라 프라이머 간 간섭이 있을 수 있다.11) 따라서 본 연구에서는 반하와 호장남성 및 대반하를 한 쌍의 특이 마커를 적용한 1회의 PCR로 대상 품목을 동시에 감별이 가능한 유전자 마커를 개발하여 보다 신속하고 명확하게 감별하고자 하였다.


재료 및 방법

실험재료 – 반하와 호장남성 및 수반하 시료는 식품의약품안전평가원에서 분양 중인 표준생약(RMPM, Reference Material of Medicinal Plant Material)을 활용하였고, 대반하는 국립생태원 및 한국한의학연구원에서 분양받아 본 연구에 사용하였다. 분양 및 수집한 시료는 DNA 바코드 프라이머를 이용하여 염기서열 분석과 SCAR 마커10)를 활용하여 동정 후 분석에 이용하였다. 그 외 국내 제주 자생지에서 반하를, 중국 하북성에서 호장남성을, 중국 장시성에서 수반하를 수집하여 SCAR 마커10)를 활용하여 동정 후 본 연구에서 개발한 마커의 적용성을 검토하였다.

DNA추출 – 표준생약과 수집한 시료를 각 개체별로 곱게 마쇄한 후 DNeasy Plant Mini Kit (Qiagen, Helden, Germany)에서 제공하는 방법에 따라 Genomic DNA 추출을 진행하였다. 추출한 Genomic DNA는 Biospec-nano (Shimadzu, Japan)를 이용하여 260 nm와 280 nm에서 흡광도를 측정하여 정량하였다.

염기서열 분석 및 종 특이 구간 탐색 – 종 특이 마커를 제작하기 위해 NCBI (National Center for Biotechnology Information) Genbank 내 등록된 반하와 호장남성의 Chloroplast genome 염기서열을 참고하였다(P. ternata : MT_193722.1, ON_462056.1; P. pedatisecta: NC_058756.1, MN_046890.1, OR_772809.1, MZ_702636.1). DNAMAN ver. 7.0 (Lynnon Biosoft, Canada)을 이용하여 정렬한 후 비교하여 종간 특이성을 가진 구간을 탐색하였다. 대반하의 경우 Chloroplast genome 염기서열 데이터가 부족하였으나, 반하와 호장남성의 Chloroplast genome 염기서열을 비교하여 얻은 petA-psbJ 부위의 삽입∙결실(Insertion/Deletion) 구간을 수집 후 동정된 대반하에 적용하여 해당 마커의 적용 가능성을 확인하였다.

PCR분석 – 표준생약과 수집한 시료에서 추출한 Genomic DNA와 10 pmol Forward primer 1 ㎕ 와 10 pmol Reverse Primer 1 ㎕ 및 PowerAmpTM 2X Premix strip (Kogenebiotech, KOREA)를 최종 20 ㎕의 반응용액에 첨가하여 C1000 Touch Cycler (Bio-rad, USA)에서 95℃에서 13분 pre-denaturaion 한 후, 95℃에서 30초 denaturation, 55℃에서 30초 annealing, 72℃에서 30초 extention을 35회 수행하고 72℃에서 5분간 final extention 시켰다. 반응이 끝난 증폭산물은 1.5% agarose gel에서 전기영동하여 증폭 산물을 확인하였다.


결과 및 고찰

특이 마커 제작 – 반하와 호장남성의 Chloroplast genome 내 petA-psbJ 구간에서 165 bp의 삽입∙결실(Insertion/Deletion) 구간을 확인하였다(Fig. 1). 이 구간을 활용하여 반하와 호장남성 및 대반하를 구별하기 위해 해당 부위를 증폭할 수 있는 특이 마커를 제작하였다(Table I).

Fig. 1.

Schematic diagram of developed molecular marker using indel (insertion/deletion) region.

Developed DNA marker using Indel (insertion/deletion) region of Chloroplast genome

Collecting samples used in this study

개발 마커의 특이성 확인 – 표준생약 3종(반하, 호장남성, 수반하) 및 대반하 시료를 대상으로 제작한 마커를 이용하여 PCR 수행한 결과, 반하에서 187 bp의 PCR 증폭 산물이, 호장남성에서 352 bp의 PCR 증폭 산물이, 대반하에서 388 bp의 PCR 증폭 산물이 확인되었고 수반하에서는 반응하지 않았다(Fig. 2, 3). 이를 통해 본 연구에서 개발한 특이 마커(CP_2F/2R)를 활용하여 반하와 호장남성 및 대반하를 동시에 감별할 수 있음을 확인하였다. 특이 마커(CP_2F/2R)를 수집한 시료에 적용한 결과, 제주에서 수집한 반하 시료 5개와 중국 하북성에서 수집한 호장남성 시료 4개 및 한국한의학연구원에서 분양받은 대반하 시료 3개는 각각 반하와 호장남성 및 대반하로 판정되었으며, 중국 하북성에서 수집한 수반하 시료 3개는 반응하지 않았다(Fig. 4).

Fig. 2.

Result of CP_2F/2R marker for P. ternata and P. pedatisecta. Lane 1 - 5: P. ternata RMPM; lane 6 - 10: P. pedatisecta RMPM; lane 11 – 15: T. flagelliforme RMPM; M: 100 bp DNA ladder.

Fig. 3.

Result of CP_2F/2R marker for P. tripartita. Lane 1 - 10: P. tripartita from NIE; M: 100 bp DNA ladder.

Fig. 4.

Result of CP_2F/2R marker for the collecting samples. Lane 1 - 5: P. ternata from Jeju; lane 6 - 9: P. pedatisecta from Hebei of China; lane 10 - 12: T. flagelliforme from Hebei of China; lane 13 - 15: P. tripartita from KIOM; N: negative; M: 100 bp DNA ladder.

특이 마커의 검출한계 확인 – 반하와 오∙혼용 우려가 가장 높은 호장남성을 대상으로 검출한계를 실험하기 위해 반하와 호장남성 시료의 비율을 1:1부터 1,000:1까지 혼합하여 검출한계를 확인한 결과, 10:1 비율까지 호장남성의 혼입을 검출할 수 있음을 확인하였다(Fig. 5). 또한, 반하와 호장남성의 Genomic DNA (20 ng/㎕)의 비율을 1:1부터 10,000:1까지 혼합하여 검출한계를 확인한 결과, 1,000:1 비율까지 호장남성의 혼입을 검출할 수 있음을 확인하였다(Fig. 6). 최근 조직배양기술을 이용해서 재배한 반하의 형태가 호장남성과 유사하다는 보고가 있어4),8) 이를 대비하기 위해 특이 마커(CP_2F/2R)의 호장남성 검출한계를 확인한 결과, 반하와 호장남성 시료의 혼입 비율이 10:1까지 검출할 수 있음을 확인하였다(Fig. 5). 반하와 호장남성 및 대반하는 Pinellia 속 식물이지만 수반하의 경우 Typhonium 속 식물로, 개발한 마커에 반응하지 않았으나, 반하와 형태적인 차이를 구별할 수 있고, 유전자 분석이 필요한 경우, 선행 연구 결과10)를 활용해 감별이 가능할 것으로 생각된다.

Fig. 5.

PCR analysis using CP_2F/2R marker for the mixed samples of P. ternata and P. pedatisecta. The mixed samples were estimated with each weight ratio (1:1 to 1000:1). For example, 1:1 ratio was mixed with a half of P. ternata and P. pedatisecta. 10:1 ratio was mixed with 90% of P. ternata and 10% of P. pedatisecta. M: 100 bp DNA ladder; N: negative coltrol; P1: P. ternata positive control; P2: P. pedatisecta positive control.

Fig. 6.

PCR analysis using CP_2F/2R marker for the mixed DNA of P. ternata and P. pedatisecta. The mixed DNA was estimated with each weight ratio (1:1 to 1000:1). M: 100 bp DNA ladder


결 론

본 연구에서는 Chloroplast genome 비교를 통해 삽입∙결실(Insertion/Deletion) 구간을 확인하였고, 이를 활용하여 반하와 호장남성 및 대반하를 구별할 수 있는 특이 마커를 개발하였다. 개발한 특이 마커(CP_2F/2R)를 이용한 유전자 분석법으로 한약재 반하와 오∙혼용 우려가 있는 호장남성 및 대반하를 1회의 PCR 만으로 효과적이고 신속하게 감별할 수 있으며, 혼입된 시료에서도 호장남성의 혼입 여부를 확인할 수 있어, 다빈도 한약재인 반하의 품질관리와 오∙혼용 방지에 활용할수 있을 것으로 생각된다.

Acknowledgments

본 연구는 식품의약품안전처 연구개발사업의 연구비지원(19171한생약195, 22201한약안141)에 의해 수행되었으며, 이에 감사드립니다.

References

  • 식품의약품안전처. (2023) 대한민국약전 제12개정.
  • Tae, K. H., Kim, D. K. and Kim, J. H. (2005) Analysis of phylogenetic relationship among Korean Pinellia Tenore (Araceae) using RAPD markers. Korean J. Pl. Taxon. 35: 161-74. [https://doi.org/10.11110/kjpt.2005.35.3.161]
  • Moon, B. C., Kim, W. J., Ji, Y., Lee, Y. M., Kang, Y. M. and Choi, G. (2016) Molecular identification of the traditional herbal medicines, Arisaematis Rhizoma and Pinelliae Tuber, and common adulter ants via universal DNA barcode sequences. Genetics and Molecular Research 15: [https://doi.org/10.4238/gmr.15017064]
  • Kang, Y., Choi, J., Lee, K., Moon, B. and Yoon, A. (2016) New insight of various methods for in vitro propagation of Pinellia ternata (Thunb.) makinoas Korean traditional herbal medicine (Pinellia Tuber). Korean Herbal Medicine Informatics 4: 43-52.
  • Jo, J. E., Lee, A. Y., Kim, H. S., Moon, B. C., Choi, G., Ji, Y. and Kim, H. K. (2013) Content comparative analysis and classification for Piniellia ternate, P. pedatisecta and Typhonium flagelliforme by HPLC-PDA analysis. Kor. J. Herbology 28: 95-101. [https://doi.org/10.6116/kjh.2013.28.5.95]
  • 식품의약품안전처 (2024) 식품의약품통계연보 제26호.
  • Kim, W. J., Choi, G., Noh, S. and Moon, B. C. (2022) A case report of imports morphological variation of Pinelliae Tuber based on the genetic analysis. Kor. J. Herbol. 37: 9-16.
  • Liu, Y., Liang, Z. and Zhang, Y. (2010) Induction and in vitro alkaloid yield of calluses and protocorm-like bodies (PLBs) from Pinellia ternata. In Vitro Cellular & Developmental Biology-Plant 46: 239-245. [https://doi.org/10.1007/s11627-009-9268-9]
  • Lee, Y. M., Moon, B. C., Ji, Y., Kim, W. J. and Kim, H. K. (2013) Molecular authentication of Pinelliae Tuber from its adulterants by the analysis of DNA barcodes, mat K and rbc L genes. The Korea Journal of Herbology 28: 53-58. [https://doi.org/10.6116/kjh.2013.28.6.53]
  • Lee, Y. M., Ji, Y., Kang, Y. M., Kim, W. J., Choi, G., and Moon, B. C. (2016) Molecular authentication of Pinelliae Tuber and its common adulterants using RAPD-derived multiplex sequence characterized amplified region (multiplex-SCAR) markers. Int. J. Clin. Exp. Med. 9: 40-50.
  • Henegariu, O., Heerema, N. A., Dlouhy, S. R., Vance, G. H. and Vogt, P. H. (1997) Multiplex PCR: critical parameters and step-by-step protocol. Bio Techniques 23: 504-511. [https://doi.org/10.2144/97233rr01]

Fig. 1.

Fig. 1.
Schematic diagram of developed molecular marker using indel (insertion/deletion) region.

Fig. 2.

Fig. 2.
Result of CP_2F/2R marker for P. ternata and P. pedatisecta. Lane 1 - 5: P. ternata RMPM; lane 6 - 10: P. pedatisecta RMPM; lane 11 – 15: T. flagelliforme RMPM; M: 100 bp DNA ladder.

Fig. 3.

Fig. 3.
Result of CP_2F/2R marker for P. tripartita. Lane 1 - 10: P. tripartita from NIE; M: 100 bp DNA ladder.

Fig. 4.

Fig. 4.
Result of CP_2F/2R marker for the collecting samples. Lane 1 - 5: P. ternata from Jeju; lane 6 - 9: P. pedatisecta from Hebei of China; lane 10 - 12: T. flagelliforme from Hebei of China; lane 13 - 15: P. tripartita from KIOM; N: negative; M: 100 bp DNA ladder.

Fig. 5.

Fig. 5.
PCR analysis using CP_2F/2R marker for the mixed samples of P. ternata and P. pedatisecta. The mixed samples were estimated with each weight ratio (1:1 to 1000:1). For example, 1:1 ratio was mixed with a half of P. ternata and P. pedatisecta. 10:1 ratio was mixed with 90% of P. ternata and 10% of P. pedatisecta. M: 100 bp DNA ladder; N: negative coltrol; P1: P. ternata positive control; P2: P. pedatisecta positive control.

Fig. 6.

Fig. 6.
PCR analysis using CP_2F/2R marker for the mixed DNA of P. ternata and P. pedatisecta. The mixed DNA was estimated with each weight ratio (1:1 to 1000:1). M: 100 bp DNA ladder

Table Ⅰ.

Developed DNA marker using Indel (insertion/deletion) region of Chloroplast genome

Primer name Primer sequence(5'-3') Species Expected size(bp)
CP_2F CCTATTATCCCATCACGGTTCG P. ternata 182
CP_2R TATGGTCCCGCTGAGTTCTTAC P. pedatisecta 352
P. tripartita 388

Table Ⅱ.

Collecting samples used in this study

Original plant P. ternata P. pedatisecta T. flagelliforme P. tripartita
#National Institute of Ecology
*Korea Institute of Oriental Medicine
**Reference Material of Mediclnal Plant Material
Collecting site Jeju, Korea Hebei, China Jiangxi, China NIE#, KIOM*
Plants & Specimens 0 0 0 13
Herbal medicine 5
4
3
0
RMPM** 5
5
5
0
Total 10 9 8 13